Recent Changes

Sunday, September 16

  1. page QPX Genome Annotation edited ... SNP table SNP detection based on RNAseq mapped to trans_v1 Annotation SNP table RNAseq m…
    ...
    SNP table
    SNP detection based on RNAseq mapped to trans_v1
    Annotation
    SNP table
    RNAseq mapped to trans_v1; limit: 2 variants; cleaned

    (view changes)
    1:09 pm

Friday, September 14

Sunday, September 2

  1. page Sonia's notebook edited ... Lab Notebook: Ecology of Marine Infectious Diseases Sonia Singhal 22 Aug 2012 Labyrinthula…
    ...
    Lab Notebook: Ecology of Marine Infectious Diseases
    Sonia Singhal
    22 Aug 2012
    Labyrinthula lab:
    Chasing after the (apparently non-specific) primers a bit...
    A BLAST search of both primers (GGAAGGCAGCAGGCGCGTAAnnnnnnnnnnnnnnnnCTATACCGACTGAGGATGGAAACATTC) turns up mostly Labyrinthula zosterae as top hits, followed by other ciliates, Desmarestia, and a few organisms that look like protists from the names. This does not explain why the primers are able to amplify bacterial DNA.
    However, the primers are located in small-subunit ribosomal sequences. These are highly conserved across taxa. Comparison of two labyrinthulids, even from opposite sides of the country (as Sammi Brombacker did) may not provide good enough resolution for the primers to work in practice.
    Ideal thing to do: Sequence some more specific regions of Labyrinthula (maybe microsatelites?) and align these among a couple Labyrinthula species and a closely related non-Labyrinthulid. Choosing some regions that are more variable across taxa may give better annealing resolution.

    21 Aug 2012
    Labyrinthula lab:
    Discovered that the GoTaq Flexi mix is only a buffer-- that is, it contains no MgCl(2) or dNTPs. Lisa got us fresh stocks of each and also mentioned that the ImmoMix was unused by anyone in the class (although it required loading dye for visualization). Sammi and I decided to hedge our bets and run a PCR from each mix. We autoclaved the remainder of the PCR tubes in preparation. Reactions were set up under the Lab 10 hood, and tubes and water were UV irradiated beforehand.
    Same reaction set used as 20 Aug.
    PCR mix 1:
    Reagent
    µL for one reaction
    Total µL
    5x GoTaq flexi buffer
    4
    X 21
    84
    BSA
    1
    21
    MgCl2 (25 uM)
    3
    63
    dNTP (10 uM)
    2
    42
    P1
    0.5
    10.5
    P2
    0.5
    10.5
    Taq
    0.2
    4.2
    PCR water
    6.8
    142.8
    Total
    18
    378
    18 uL of mix aliquoted per tube and 2 uL of the appropriate DNA added. Primers as per 20 Aug.
    PCR mix 2:
    Reagent
    µL for one reaction
    Total µL
    ImmoMix
    12.5
    X 21
    262.5
    BSA
    1.5
    31.5
    P1
    0.8
    16.8
    P2
    0.8
    16.8
    PCR water
    7.4
    155.4
    Total
    23
    483
    23 uL of mix aliquoted per tube and 2 uL of the appropriate DNA added. Primers as per 20 Aug.
    Cycle (both mixes):
    Step
    Temperature (C)
    Time
    1
    95
    10 min
    40 cycles of:
    2
    95
    30 min
    3
    50
    30 sec
    4
    72
    60 sec
    5
    72
    10 min
    Visualization on a 2% agarose gel (60 min at 65V) showed no bands for the Flexi mix, but there were bands for the ImmoMix!
    {labyGel_21Aug.png}
    Order of wells:
    1. Phylloplesia head
    2. Phylloplesia gonads
    3. Phylloplesia gizzard
    4. Phylloplesia digestive tract
    5. Phylloplesia nidamental gland
    6. Phylloplesia posterior
    7. Lacuna diseased 1
    8. Lacuna diseased 2
    9. Lacuna diseased 3
    10. Lacuna healthy 1
    11. Positive control
    12. Lacuna healthy 2
    13. Lacuna healthy 3
    14. CK Shallow Bay culture
    15. FB Sh T-1-D culture
    16. FB Sh T-1 culture
    17. Beach Haven (extraction 1 Aug)
    18. Vibrio RE22
    19. Sandy's monoculture
    20. Positive control
    21. Negative control
    Results:
    Sammi got some good evidence that Laby is located in the Phylloplesia digestive tract, as opposed to being in other places.
    The Lacuna results are inconclusive.
    Cultures CK Shallow Bay, FB Sh-T-1-D, BH, and Monoculture seem to match the positive control.
    ...On the other hand, we also had amplification from Vibrio DNA, which means that our primers are not very specific.
    ...Also, we're amplifying something in the negative control in spite of all the care we took to stay sterile.

    20 Aug 2012
    Labyrinthula lab:
    (view changes)
    10:25 pm
  2. 10:04 pm
  3. page Sonia's notebook edited ... Lab Notebook: Ecology of Marine Infectious Diseases Sonia Singhal 21 Aug 2012 20 Aug 2012 …
    ...
    Lab Notebook: Ecology of Marine Infectious Diseases
    Sonia Singhal
    21 Aug 2012
    20 Aug 2012
    Labyrinthula lab:
    Visualization of PCR products from yesterday, run on 2% agarose gel for 60 min at 65 V (done because we're using the bad ladder that smeared last time). Photo not included because there were no bands whatsoever to be seen, including for the positive control. (The ladder, however, looked gorgeous.) We thought that perhaps since the power had gone out in the middle of the night, the PCR hadn't finished properly.
    Re-ran the PCR. I added in previous BH and monoculture extractions.
    PCR mix:
    Reagent
    µL for one reaction
    Total µL
    5x GoTaq flexi mix
    5
    X 21
    105
    BSA
    1.5
    31.5
    P1
    0.8
    16.8
    P2
    0.8
    16.8
    PCR water
    14.65
    307.65
    Taq
    0.25
    5.25
    Total
    23
    483
    Primers:
    Forward, 5’ GGAAGGCAGCAGGCGCGTAA 3’
    Reverse 5’ GAATGTTTCCATCCTCAGTCGGTATAG 3’
    2 uL of each DNA sample added to each reaction. Positive control: Pool Laby + (stock); Negative control: PCR water
    Cycle conditions:
    Step
    Temperature ( C)
    Time
    1
    95
    10 min
    40 cycles of:
    2
    95
    30 min
    3
    50
    30 sec
    4
    72
    60 sec
    5
    72
    10 min
    Reactions removed from the PCR machine as soon as they finished. Another gel visualization still showed... no bands whatsoever.
    Maybe our sterile technique was too sterile?
    19 Aug 2012
    Labyrinthula lab:
    Redo of DNA extraction and PCR:
    Sammi and I autoclaved all tubes we wanted to use (1.5-mL, 2-mL, PCR) and got new aliquots of all materials. Lisa gave us an untouched GoTaq Flexi mix to use for PCRs.
    Extractions as per 18 Aug-- only CK and FB cultures redone. Sammi dissected different parts of a Phylloplesia to try to isolate which organs Laby might be present in. I added a Vibrio (RE22) extraction as a definite negative control and did it completely under the hood--not as a sterile space, but as a Laby-free space. PCR tubes and water UV'ed under the hood for 20 min before use.
    PCR mix: Flexi Taq
    Reagent
    µL for one reaction
    Total µL
    5x GoTaq flexi mix
    5
    X 19
    95
    BSA
    1.5
    28.5
    P1
    0.8
    15.2
    P2
    0.8
    15.2
    PCR water
    14.65
    278.35
    Taq
    0.25
    4.75
    Total
    23
    437
    Primers:
    Forward, 5’ GGAAGGCAGCAGGCGCGTAA 3’
    Reverse 5’ GAATGTTTCCATCCTCAGTCGGTATAG 3’
    2 uL of each DNA sample added to each reaction. Positive control: Pool Laby + (stock); Negative control: PCR water
    Cycle conditions:
    Step
    Temperature ( C)
    Time
    1
    95
    10 min
    40 cycles of:
    2
    95
    30 min
    3
    50
    30 sec
    4
    72
    60 sec
    5
    72
    10 min
    6
    10
    overnight

    18 Aug 2012
    Labyrinthula lab:
    ...
    23
    322
    Primers:
    Forward, 5’ GGAAGGCAGCAGGCGCGTAA 3’
    Reverse 5’ GAATGTTTCCATCCTCAGTCGGTATAG 3’
    (view changes)
    6:18 pm
  4. page Sonia's notebook edited ... Lab Notebook: Ecology of Marine Infectious Diseases Sonia Singhal 18 Aug 2012 Labyrinthula…
    ...
    Lab Notebook: Ecology of Marine Infectious Diseases
    Sonia Singhal
    18 Aug 2012
    Labyrinthula lab:
    DNA extraction and PCR of Labyrinthula cultures:
    Plated cultures used:
    1 : Sandy 1.17.1 from the eelgrass infection plate, 8/7
    2 : Shallow Bay 1 CK, 7/18
    3 : Replate of FB Sh-T-1-D, plated 8/11
    4 : FB Sh-T-1, replate for Herbivores 8/11
    Scraping of each culture put into 700 uL ASL; DNA extracted using the QIAgen Stool kit (protocol under 26 July). Sample #2 had the lid pop off during the centrifugation at Step 13, but no liquid was lost. All other lids remained closed.
    Sammi extracted DNA from her Lacuna snails.
    PCR mix: GoTaq
    Reagent
    µL for one reaction
    Total µL
    GoTaq mix
    12.5
    X 14
    175
    BSA
    1.5
    21
    P1
    0.8
    11.2
    P2
    0.8
    11.2
    PCR water
    7.4
    103.6
    Total
    23
    322
    Primers:
    Forward, 5’ GGAAGGCAGCAGGCGCGTAA 3’
    Reverse 5’ GAATGTTTCCATCCTCAGTCGGTATAG 3’
    2 uL of each DNA sample added to each reaction. Positive control: Pool Laby + (stock); Negative control: PCR water
    Cycle conditions:
    Step
    Temperature ( C)
    Time
    1
    95
    10 min
    40 cycles of:
    2
    95
    30 min
    3
    50
    30 sec
    4
    72
    60 sec
    5
    72
    10 min
    Visualization on 1.5% agarose gel:
    {LabyGel_18Aug.png}
    Order of wells:
    1. Healthy Lacuna 1
    2. Healthy Lacuna 2
    3. Healthy Lacuna 3
    4. Diseased Lacuna 1
    5. Diseased Lacuna 1
    6. Diseased Lacuna 2
    7. Diseased Lacuna 3
    8. * (previous Lacuna extraction?)
    9. Positive control
    10. Negative control
    11. Laby culture 1
    12. Laby culture 2
    13. Laby culture 3
    14. Laby culture 4
    15. Beach Haven (extracted 1 Aug)
    16. Positive control
    ...Because our negative control also shows bands, the results of the PCR are rather dubious. Since we were using the class reagents, something may have gotten contaminated...

    17 Aug 2012
    Bioinformatics lab:
    (view changes)
    5:33 pm
  5. 5:03 pm
  6. page Sonia's notebook edited ... Labyrinthula lab: Seawater took a long time to sterilize--autoclave kept aborting! Finally re…
    ...
    Labyrinthula lab:
    Seawater took a long time to sterilize--autoclave kept aborting! Finally realized that it needed more water. Also got more bleach for sterilizing clips.
    ...
    general protocol. Notes:Notes of details and modifications follow.
    1. Culture inoculum

    Blades dipped in Betadine, then sterile seawater. Betadine worked extremely well--leaves still looked distinctively green afterward.
    Plates numbered separately for clip inocula and liquid inocula
    ...
    Short mix-up with numbering, but it was cleared up.
    Scratches (3 small < 1cm) made longitudinally in about the middle of the blade with a pointed tool. Only broke the surface layers of cells
    ...
    blades left overtheseover, these were switched
    All other plates were filled as labeled. One plate was left over.
    Culture used: BH Laby culture used in the 10 Aug trial; 15 mL of the original (resuspended) culture had been kept going.
    Culture concentration: 8.6 x 10^6 => 3.44 x 10^4 cells/mL per plate in the 10^0 plates, 34.4 cells/mL per plate in the 10^(-2) plates.
    As before, the monoculture is too low a density to consider using.
    2. Clip inoculum

    The 1* culture from 6 Aug had grown over the inoculum leaves, so we additionally ran a second clip trial with that strain. Control plate looked uncontaminated, so 2 non-infected leaf-halves were included as negative controls.
    Photos:
    (view changes)
    4:08 pm
  7. page Sonia's notebook edited ... Seawater took a long time to sterilize--autoclave kept aborting! Finally realized that it need…
    ...
    Seawater took a long time to sterilize--autoclave kept aborting! Finally realized that it needed more water. Also got more bleach for sterilizing clips.
    See 15 Aug for general protocol. Notes:
    ...
    then sterile seawaterseawater. Betadine worked extremely well--leaves still looked distinctively green afterward.
    Plates numbered separately for clip inocula and liquid inocula
    All blades photographed, cleaned and put in plates first
    Short mix-up with numbering, but it was cleared up.
    Scratches (3 small < 1cm) made longitudinally in about the middle of the blade with a pointed tool. Only broke the surface layers of cells
    ...
    blades left over, theseoverthese were switched
    All other plates were filled as labeled. One plate was left over.
    Culture concentration: 8.6 x 10^6 => 3.44 x 10^4 cells/mL per plate in the 10^0 plates, 34.4 cells/mL per plate in the 10^(-2) plates.
    The 1* culture from 6 Aug had grown over the inoculum leaves, so we additionally ran a second clip trial with that strain. Control plate looked uncontaminated, so 2 non-infected leaf-halves were included as negative controls.
    Photos:
    1*-1
    {1star-1_17Aug.JPG}
    1*-2
    {1star-2_17Aug.JPG}
    Control
    {blade_control_17Aug.JPG}
    Gregor and Courtney will be taking photos of all inoculated leaves ~ every 12 hours so that we can get time-series data on lesion development.

    16 Aug 2012
    Bioinformatics lab:
    (view changes)
    3:59 pm
  8. 3:56 pm

More